Site Loader
Rock Street, San Francisco

Human T cell lymphotropic virus type 1 (HTLV-1) is an
ancient retrovirus that causes leukemia and the neurological disorder HTLV-1
associated myelopathy or tropical spastic paraparesis (HAM/TSP). Although
HLTV-1 infection distributed globally but some regions are endemic. Despite the
virus has a conserved genome, molecular epidemiology on human movement and transmission
pathways has been useful for determining the time of introducing the virus into
countries. In current study, we analyzed the genetic variability of LTR region
of infected individuals lived in Mashhad. Sequencing and comparison analysis
from different HTLV-1 isolates showed 0.8% to 1.2% variability in genome.
Phylogenetic studies let us to include these isolates in the transcontinental
subgroup A in which samples isolated from Torbat-e-heydariyeh and Neyshabur are
also found. Further Phylogenetic analysis will provide
insight into genetic heterogeneity and help to understand the history,
evolution, origin and spread of HTLV-1.

Key words:
human T cell lymphotropic virus type 1 – HTLV-1 associated myelopathy/tropical
spastic paraparesis – HTLV-1 phylogeny – Mashhad

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

introduction

Human T-lymphotropic virus type 1(HTLV-1) is the first known retrovirus causes HTLV- associated myelopathy/tropical spastic paraparesis (HAM/TSP) and adult T-cell leukemia (ATL) disorders(2, 3). In addition, the virus is considered to be contribute in various inflammatory diseases most notably uveitis, arthritis, myositis and alveolitis (2-4). Although the distribution of HTLV-1 is global, but the higher rates of infected individuals have been observed in southern Japan, Africa, the Caribbean, South America (5) and more recently Iran ; a region with an increasing rate of HTLV-1 cases (6). In these regions, between 0.5 and 20% of the general population have HTLV-1 antibodies and are considered to be healthy carriers(7). Most of HTLV-1 infected individuals remain asymptomatic carriers (ACs) through their lives and in a few subjects HTLV-1-associated diseases will develop(8). The first infected adults were detected by Farid in 1993 with 2.1% prevalence, an ancient populous city with more than 25 million pilgrims and visitor annually.

On the molecular
level, HTLV-1 genome is very stable. HTLV-1-genome show a low degree of genetic
variation (0.5 to 3%) and high identity in nucleotide sequences among
HTLV-1 strain (13, 14). Moreover, disease-specific sequences
have not been found for HTLV-1 associated diseases, Instead the genomic
variability of HTLV-1 appears to depend on geographic origin more than the
pathology.

MATERIALS
AND METHODS

 

HTLV-1-infected samples whom clinical diagnose of HAM/TSP /ATL and ACs were participated in this study. These
specimens were chosen from volunteers who were referred to Department of
Neurology at the Ghaem Clinic after confirmation tests. All ACs were diagnosed
as HTLV-1 carriers at the time of blood sampling. Serum samples were tested for detection of anti-HTLV-1 and 2 antibodies
using ELISA method, then positive results were confirmed by PCR using the
primer targeted Tax gene. Moreover, we explained
all the goals and methods of the study briefly for our patients and came to an
agreement to obtain written informed consent. Briefly, 6 ml blood
samples were obtained from 15 infected individuals living in Mashhad. Peripheral blood mononuclear cells (PBMCs) were separated from
blood samples by using ficoll method. DNA was extracted from PBMCs using the DNA
Genomic Purification Kit (Blood mini kit, Qiagen, Germany) according to protocols recommended
by manufacturer and samples were stored at ?20 ?C.

Thereafter, Polymerase chain
reaction (PCR) was performed on seventy nanograms of DNA to amplify complete LTR region approximately 780bp long and
corresponding to position 60 to 830 in ATK-1, the prototype Japanese HTLV-1 strain, using one set of overlapping oligonucleotide
primers designed by Geneious software 9.0.5. LTR-A
forward (5? TAGAGCCTCCCAGTGAAAAAC -3?), LTR-B reverse (5?-TTTGGGAGTAGGCTGGCTAG -3?).
Assembling all reactions components for PCR amplification was carried out on
ice and quickly transferred reactions to a thermocycler preheated to the
denaturation temperature 95°C. The procedure was done in a 25 ul volume that
contained 25M MgCL2 -1.5ul, 10M dNTPs -0.5ul, 10× Reaction Buffer-2.5, 0.5ul
Prime Accupol™ DNA Polymerase, template DNA 2ul, 0.5 ul of each specific
primer, 17 ul dH2O. The PCR machine (Astec PC700, Kyoto, Japan) using an
initial denaturation step at 95°C for 5 minutes, followed by 30 cycles of 95°C
for 30 seconds and 60°C for 30 seconds, 72°C 1 minute and a final extension of
72°C for 5 minutes. Gel was stained by ethidium bromide, then electrophorese on
2% agarose gel with molecular-weight size marker and a sample (5 ul) of each
amplified product were conducted in TAE buffer (Tris-acetate EDTA) at 70V for
30 minutes and visualized under UV light.

 

Cloning and
sequencing of the amplified LTR fragment 

 

PCR
products were purified using GeNet Bio Gel Extraction (GeNet bio). The
amplified LTR region fragments were cloned into pTZ57R/T vector using TA cloning
method. The plasmid was extracted by using a plasmid purification kit
generally, one clone per amplification products were sequenced in both
directions by Macrogen (www.macrogen.com).
Sequences were then analyzed using Geneious software and compared with the HLTV
ATK-1 prototype (accession number J02029)

 

Results

 

The studied
groups consisted of 15 confirmed HTLV-1 infected adults whom clinically diagnosed with HTLV-1 associated disease, it
was possible to amplify a fragment of the expected size of 767 bp with
designated primers LTR-A and LTR-B. Almost HTLV-1 LTRs of all DNA specimens
were completely sequenced.

Sequence analysis –
We therefore purified a 767 bp segment (Fig. 1) from all samples. The amplified
fragment from these samples was cloned into the pTZ57R/T cloning vector and one clone
per amplification products were sequenced in both directions by Macrogen (www.macrogen.com). Obtained
sequences from the samples showed the trustworthy of amplified fragments with homogeneous
population of PCR products, and the variations observed were as a result of
alternations in viral genomic sequences linked to the geographic origins. Thus, most of the diversity in
local strains were not known to inhibit viral expression or replication. In order to obtain information concerning LTR nucleotide
diversities, all the collected sequences were compared with the equivalent sequenced
derived from different regions of Khorasan province and other endemic areas. Sequence
analysis revealed that the 13 nucleotide sequences from patients were exactly
identical and showed no significant differences within studied group. The exceptions to this general
pattern were two alternations in HAM/TSP85 samples (A285 to
C, A541 to
G) and one alternation was in an ATL
90 case at position C696 to T, which
is located in the R and U5 regions, respectively. LTR alignment from isolates showed 99.7-100% similarity
amongst the sequences. These nucleotide variations may be primarily a result
from their low fidelity related to the reverse transcriptase enzyme.

Nucleotide alignment
were carried out among sequences and compared with the sequences of the HTLV-1
strains from various geographic distant regions including Japan (ATK- 1, H5,
TSP-1, MT-2; Seiki et al. 1983, Gray et al. 1990), the Caribbean area (HS-35,
CH; Malik et al. 1988, Ratner et al. 1991), Brazil (pt-8; Schultz et al. 1991),
Romania (H990; Schultz et al. 1991), Melanesia (MEL-1; Gessain et al. 1993),
the United States (SP; Paine et al. 1991), a variant from Gabon (GeneBank
Accession number L33266; Moynet et al. 1995), Chile (ST; Dekaban et al. 1992)
and Zaire (EL; Paine et al. 1991, Ratner et al. 1991), as well as the sequences
of human T-cell lymphotropic virus type I from Torbat-e-Heydarieh and Neyshabur
from Khorasan provinces (Watanabe et al. 1985) and sequences of HTLV-1 strain
Mo from the United States (Shimotohono et al. 1985).

Alignment of the
sequences of the 767bp segment of the Japanese HTLV-1 strain ATK-1 (Fig. 3),
with sequences from this study exhibited a 1.5-2.4% dissimilarity. The variability among
the sequences obtained from the Mashhadi strains was 0.5%. The nucleotide
sequences for this fragment showed that there are alternations in nucleotide G36 to
A, C37 to
G, G172 to
A, A241 to G, represented
a distinctive feature of the local isolates when compared to the ATK-1 strain.
Despite this overall low degree of genomic variability in nucleotide sequence, no nucleotide variations were observed in the poly(A) signal
(AATAAA), the TATA box and the CAP site, comprising nucleotide 88 to 98 on the LTR gene, was totally conserved between the HTLV-
1 Mashhadi strain sequences Office1 examined here.

Phylogenetic analysis –  The
phylogenetic trees constructed were very similar by two different methods (UPGMA, NJ) using the 767 bp LTR gene. Although similar, we selected the NJ method because it provided the
most illustrative phylogenetic tree. As shown in Fig. 4, three main groups were
clearly identified. In the first group appeared strain ptM3 of HTLV-1 that
represents an early ancestor from which the Melanesian and cosmopolitan strains
diverged, whereas in the second group appeared the Melanesian MEL-1 strain. The
third group or cosmopolitan subgroup appeared clearly separated from the
African and Melanesian groups and contained the Mashhadi strains described here and distinguishable from reference sequences for groups B, C, D,
E, F, and G. Office2 

Our results suggest
that these Mashhadi isolates can be clustered with the same group as other Khorasan
province and Iran isolates such as Mashhadi jew and Mashhadi immigrant patient
to German with the same clade with cosmopolitan (a) subtype. Although the analysis shows that
the strains from Japan and Africa seem not to be in the same branch as the
strains described here Mashhad, they do not form a completely separate
subgroup. Office3 

The sequences were submitted to Gen Bank after analysis: BankIt1824992 HTLV-1_LTR
(Torbat-e Heydarieh __Iran) KR819400

 

 

Fig. 1. Alignment of the nucleotide sequence of the LTR from
different HTLV-I isolates. Only those changes observed with other published sequence
are mentioned. Nucleotide positions are numbered according to the ATK-1
prototype sequence starting from the first LTR nucleotide (14). Points represent homologies. 13 HTLV-1 –LTR local isolates
were identical. HAM/TSP85 and ATL90 were the exceptional.

Discussion

There is close relationship between the phylogenetic HTLV-1 genotypes and
the geographical origin of infected- individuals, although up to date the
significant correlation exists between diversities observed in geographical
origins and clinically pathology outcomes are not well identified. HTLV-1
phylogenetic studies of different ethnic groups are helpful because it assists
to identify the probable time of introducing and spreading the different HTLV-1
strains into countries and investigate the possible origins of HTLV-1 in
endemic areas during mobility of human populations. These proofs confirm the
nucleotide heterodiversities observed in different HTLV-1 strains. Here, we define
the full-length sequence of LTR region of infected individuals lived in Mashhad, a populous town where
the most Caucasians residents have different economic,
social, health and cultural background in northeast of Iran. Mashhad has higher level of HTLV-1 antibodies in blood
donors as compared to that blood donors from different provinces of Iran and
the prevalence of HTLV-1 in one of the highest in Asia. Seroprevalence studies conducted
between 2005 to 2013 indicated low prevalence of HTLV-1infection in different
provinces in Iran (Azerbaijan, Ilam, Hormozgan, and Bushehr, the percentages of
blood donors with the virus were 0.34, 0.21, 0.18, and 0.01% respectively,
suggesting an unseen threat for the public health. So, it is necessary to educate and
increased awareness concerning the sexually/blood transmitted diseases or transition pathways in general
population to decreased the number of new
infections.

 

From 15 confirmed samples who had been clinically
diagnosed HTLV-associated diseases, 5 patients were ACs, 5 patients were ATL
and 5 infected adults were HAM/TSP that were recognized as HTLV-1 positive by
two certain different serology methods. Analysis of sequences indicated that
all sequenced LTR showed an identical pattern in nucleotide sequences among samples
from Torbat-e-heydariyeh. The nucleotide pattern observed among samples
permitted us to primarily assume the presence of variation in the sequence
which was specific of certain geographical origin as compared to the isolate
ATK-1 (GeneBank accession numbers J02029).

For
the phylogenetic studies and ascertain genotype, The LTR region
was selected because the certain noncoding and theoretically
nonfunctional regions of the LTR, specially the U3 fragment, are useful for viral subtype characterization
because of highest variability rather than other regions of the virus (14) while other regions of LTR that initiate
transcription, polyadenylation and spicing have more constant region.
For this purpose the current study focused on 767 base pair fragment of the LTR
gene, to analyze the genetic similarities in fifteen of the isolates specimens
since such a gene initiates transcription,
polyadenylation and splicing. We, and other ( Rafaat panah) have observed G36 to
A, C37 to
G, G172 to
A, A241 to G,
when compared to the ATK-1 isolate as a reference. By aligning the sequences of
the reference strains and sequences from isolates of current study with other
HTLV-1 sequences of geographically distant strains, they indicated considerable
similarities in nucleotide sequences when compared to the ATK-1 prototype
strain. Nucleotide similarity was: T (Chile) 0.8%, pt-8 (Brazil) 0.8%, ATK-1,
MT- 2, TSP-1, H-5 (Japan) 1.2– 2.3% and CH (Caribbean) 1.4%. However, Low evolutionary, constant genome
and high similarities in sequences have been reported for each HTLV-1-patient
by molecular epidemiology, but up to date no specific-disease nucleotide
variations recommended to develop ATL or HAM/TSP from virus carriers. So,
geographical origin, transmission routs, host genetics seem to associate with
clinical symptoms. Along with previously studies, on the molecular level,
HTLV-1 have shown low drift of diversities in nucleotide sequences amongst
HTLV-1 isolates in Sabzevar and other endemic populations. Thus, the diversities observe in nucleotide among HTLV-1 strains representing the close
correlation with geographical origin of the HTLV-I strain than the pathology.

To
validate the trustworthiness of the topology of the phylogenetic tree
constructed, different methods such as UPGMA and NJ were used. Data analysis
indicated that it is likely to observe local isolates are closely related to
isolate from Torbat-e-heydariyeh, Sabzevar and Neyshabur and all the strains
studies here belong to the Cosmopolitan group. In this examination is also
possible to notice that the Japanese
strains MT-2, TSP-1 as well as strains EL from Zaire, a variant from Gabon, and
HS-35 from the Caribbean area cluster with the different group. This finding is in
agreement with other studies conducted in different geographical suggested that
the Cosmopolitan subtype was found to be widespread. Similarly, Cosmopolitan
type was observed in the Reunion Island, Iranian-born Mashhadi Jews and Kuwaiti
HTLV-I isolates, strongly suggesting the common origin of all these isolates.

Several
lines of proof here suggested that spreading of HTLV-1 infection through
American continent initiated with the first human population movement. in
contrast, other phylogenetic analysis revealed that the origin of all HTLV-1
subtype is Africa, according to the absence of HTLV-1 among Amerindians and the
high prevalence of infection among individuals of African descendent in the
Caribbean area and in South America. It is possible that HTLV-1 was brought to
Mashhad by African slave immigrants as suggested by felani. These researchers
propose that HTLV-1 originated in region called an Indian Malayan, from there
apparently distribute to Africa by marines thousands of years ago, and that
later due to slave trade in the XVI century, it spread to the New World and
Iran. An analysis of the LTR region of HTLV-1 isolates from different ethnic groups of endemic regions have
suggested that the virus may have been introduced into Iran on a number of
occasions from several African heredities, probably during and after the slave
trade or through recent Mongoloid
invasion when the city served as an important crossroad and trade center (Van Dooren et al. 1998). HTLV-1
is predominantly frequent among descendants of African slaves.
Amongst these hypothesis, Slavery seems more likely to have introduced the
virus to these cities, because it has been commonly performed even before the
rise of Islam in these cities. As a consequence of increased human mobility, HTLV-1a infection has also reached different Iran’s neighbors, such as
Pakistan, turkey, Saudi Arabia, whereas HTLV-1 is still uncommon in the general
population. Furthermore, the social
interaction among countries such as international trade, tourism, and
pilgrimage seems to be playing a central role in virus dissemination. Phylogenetic
analyses of the LTR region in the virus isolates examined here as well as in
strains from different ethnic groups in Iran’s neighbors will make it possible to confirm the origin
of the HTLV-1 strains in these populations and to determine the exact time of
introduction of viral strains into Iran especially Mashhad.

 

 

 

 

 

 

 

 

 

 

 

 

 Office1Masaln
migi nigah kardam hich taghiri dar u3 ya felan ya felan moshahgede nakardam

 Office2Kamelan
ba Mehran sohbat kon

 Office3Ba
Mehran kamel chek kon

Post Author: admin

x

Hi!
I'm Dora!

Would you like to get a custom essay? How about receiving a customized one?

Check it out